Sequence ID | >WENV180413502 |
Genome ID | OBVB01002651 |
Search identical group | |
Phylum/Class | [OBVB] human gut metagenome; faeces |
Species | |
Start position on genome | 1839 |
End posion on genome | 1767 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
agaatgaccc |
tRNA gene sequence |
GGGCGGTTGGCGCAGTGGTAGCGCACTTCCCTGACACGGAAGGGGTCACAAGTTCGAATC |
Downstream region at tRNA end position |
gatgaatcgc |
Secondary structure (Cloverleaf model) | >WENV180413502 Val GAC c ACtc gatgaatcgc G - C G - C G - C C - G G - C G + T T - A T A T T G T T C A G A G | | | | | G T C G C G A C A A G C G | | | | T T G G C G C T A A GGGTC C - G T - A T - A C - G C - G C C T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |