Sequence ID | >WENV180420650 |
Genome ID | OBVO01016358 |
Search identical group | |
Phylum/Class | [OBVO] human gut metagenome; faeces |
Species | |
Start position on genome | 59 |
End posion on genome | 134 |
Amino Acid | Lys |
Anticodon | CTT |
Upstream region at tRNA start position |
acaaaaacat |
tRNA gene sequence |
GCGCCATTAGCTCAGTTGGTAGAGCACCTGACTCTTAATCAGGGTGTCCCGGGTTCGAGT |
Downstream region at tRNA end position |
agcgggagat |
Secondary structure (Cloverleaf model) | >WENV180420650 Lys CTT t ACCA agcgggagat G - C C - G G - C C - G C - G A - T T - A T G T G T C C C A T G A A | | | | G T C T C G C C G G G C G | | | | T T G G A G C T A A GTGTC C - G C - G T - A G - C A - T C A T A C T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |