Sequence ID | >WENV180422443 |
Genome ID | OBVT01000302 |
Search identical group | |
Phylum/Class | [OBVT] human gut metagenome; faeces |
Species | |
Start position on genome | 12735 |
End posion on genome | 12662 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
taaaacagtT |
tRNA gene sequence |
GCCGCTATAGTTAAATGGTATAATAGAGCAATGGTAATGCTCCGTTCCGAGTTCAATTCT |
Downstream region at tRNA end position |
gtgataaagt |
Secondary structure (Cloverleaf model) | >WENV180422443 Thr GGT T ATCt gtgataaagt G - C C - G C - G G + T C - G T + G A - T T T T G G C T C A A A A | | | | | A T A T T G C C G A G C G | | | + T T G T A A T T A A CGTT G - C A - T G - C C - G A - T A A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |