Sequence ID | >WENV180431730 |
Genome ID | OBWH01002053 |
Search identical group | |
Phylum/Class | [OBWH] human gut metagenome; faeces |
Species | |
Start position on genome | 50 |
End posion on genome | 138 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
gtaattgtaa |
tRNA gene sequence |
GGAGAGGTGCTCGAGTGGTTGAAGAGGCACGCCTGGAAAGCGTGTATACCCCTAAAGGGT |
Downstream region at tRNA end position |
cattttttac |
Secondary structure (Cloverleaf model) | >WENV180431730 Ser GGA a GCat cattttttac G - C G - C A - T G - C A - T G - C G + T T A T T G C T C A T G A G | | | | | G G G C T C A C G A G C G | | | T T T A G A G T G A G TATACCCCTAAAGGGTATC C - G A - T C - G G - C C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |