Sequence ID | >WENV180434065 |
Genome ID | OBWK01006478 |
Search identical group | |
Phylum/Class | [OBWK] human gut metagenome; faeces |
Species | |
Start position on genome | 799 |
End posion on genome | 714 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
cagaataaac |
tRNA gene sequence |
GCTCTGGTGGTGGAATTGGTAGACACGCTATCTTGAGGGGGTAGTGGCCGCAGGCCGTGC |
Downstream region at tRNA end position |
aatataaacc |
Secondary structure (Cloverleaf model) | >WENV180434065 Leu GAG c ACCA aatataaacc G - C C - G T - A C - G T - A G - C G - C T G T C G C T C A T A A G | | | | | A T G G T G G C G A G C G | | | T T G A C A C T A G G TGGCCGCAGGCCGT C - G T - A A - T T + G C - G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |