Sequence ID | >W141041550 |
Genome ID | AMCD02000001 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Pseudomonas mendocina S5.2 [AMCD] |
Start position on genome | 4725474 |
End posion on genome | 4725558 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
ccgccatcgt |
tRNA gene sequence |
GCCCCGGTGGCGGAATCGGTAGACGCGGCGGATTCAAAATCCGTTTTCGAAAGGAGTGGG |
Downstream region at tRNA end position |
cgattcgaag |
Secondary structure (Cloverleaf model) | >W141041550 Leu CAA t ACCA cgattcgaag G - C C - G C - G C - G C - G G - C G - C T G T C C C T C A T A A G | | | | | G C G G C G G G G A G C G | | | T T G A C G C T A G G TTTCGAAAGGAGT G + T C - G G - C G - C A - T T A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |