Sequence ID | >W141042719 |
Genome ID | AMES01000167 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Capnocytophaga sp. oral taxon 380 oral taxon 380 str. F0488 [AMES] |
Start position on genome | 17237 |
End posion on genome | 17164 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
gaaatgtgat |
tRNA gene sequence |
TGGTCTATGGTGTAATGGTAACACAGCAGATTTTGGTTCTGTTATTCTAGGTTCGAGTCC |
Downstream region at tRNA end position |
aaggcttcct |
Secondary structure (Cloverleaf model) | >W141042719 Gln TTG t ACAA aaggcttcct T - A G - C G - C T - A C - G T - A A - T T G T G A T C C A A A G | | | | | G T T G T G C T A G G C G | | | | T T G A C A C T A A TATT G + T C - G A - T G - C A - T T T T G T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |