Sequence ID | >W141042808 |
Genome ID | AMEV01000085 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Capnocytophaga sp. oral taxon 324 oral taxon 324 str. F0483 [AMEV] |
Start position on genome | 6147 |
End posion on genome | 6219 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
ttttttgtat |
tRNA gene sequence |
GCTGATGTAGCTCAGGGGTAGAGCACTTCCTTGGTAAGGAAGAGGTCACGAGTTCAAATC |
Downstream region at tRNA end position |
acgtattttg |
Secondary structure (Cloverleaf model) | >W141042808 Thr GGT t TCtc acgtattttg G - C C - G T - A G - C A - T T - A G - C T A T T G C T C A G A A | | | | | A G C T C G A C G A G C G | | | | T T G G A G C T A A AGGTC C - G T - A T - A C - G C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |