| Sequence ID | >WENV180453560 |
| Genome ID | OBXM01000229 |
| Phylum/Class | [OBXM] human gut metagenome; faeces |
| Species | |
| Start position on genome | 3536 |
| End posion on genome | 3610 |
| Amino Acid | Gln |
| Anticodon | TTG |
| Upstream region at tRNA start position |
ctgagcagac |
| tRNA gene sequence |
AGCCCCATAGTGTAATTGGTAACACACCTGATTTTGGTTCAGTATTTCTAGGTTCGAGTC |
| Downstream region at tRNA end position |
atccaaccct |
| Secondary structure (Cloverleaf model) | >WENV180453560 Gln TTG
c GCCA atccaaccct
A - T
G - C
C - G
C - G
C - G
C - G
A - T T G
T G G T C C A
T A A A | + | | | G
T T G T G C T A G G C
G | | | | T T
G A C A C
T A A ATTT
C T
C - G
T - A
G - C
A - T
T T
T G
T T G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |