| Sequence ID | >WENV180462196 |
| Genome ID | OBYB01000434 |
| Phylum/Class | [OBYB] human gut metagenome; faeces |
| Species | |
| Start position on genome | 11940 |
| End posion on genome | 11868 |
| Amino Acid | fMet |
| Anticodon | CAT |
| Upstream region at tRNA start position |
gcgactatat |
| tRNA gene sequence |
CGCGGAGTGGAGCAGTGGTAGCTCGTTGGGCTCATAACCCAAAGGTCGTAAGTTCGAGTC |
| Downstream region at tRNA end position |
aaaagtcctc |
| Secondary structure (Cloverleaf model) | >WENV180462196 fMet CAT
t ACta aaaagtcctc
C A
G - C
C - G
G - C
G - C
A - T
G - C T G
T C G T T C A
G A G | + | | | G
T C G A G G T A A G C
G | | | | T T
G G C T C
T A G AGGTC
T - A
T - A
G - C
G - C
G - C
C A
T A
C A T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |