Sequence ID | >WENV180462389 |
Genome ID | OBYB01001822 |
Search identical group | |
Phylum/Class | [OBYB] human gut metagenome; faeces |
Species | |
Start position on genome | 6775 |
End posion on genome | 6701 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
ttgggaacat |
tRNA gene sequence |
GGGCTCGTCGTTCAATGGATAGGACATCGGTTTCCGGTACCGACGATGTAGGTTCGATTC |
Downstream region at tRNA end position |
gacttttcat |
Secondary structure (Cloverleaf model) | >WENV180462389 Arg CCG t ACCA gacttttcat G + T G - C G - C C - G T + G C - G G - C T T T C A T C C A T A A C | | | | | G G C T T G G T A G G C G | + | | T T A G G A C T A A CGAT T - A C - G G - C G - C T - A T T T G C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |