Sequence ID | >WENV180468446 |
Genome ID | OBYJ01020305 |
Search identical group | |
Phylum/Class | [OBYJ] human gut metagenome; faeces |
Species | |
Start position on genome | 347 |
End posion on genome | 271 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
aattacatat |
tRNA gene sequence |
GGGCCTATAGCTCAGCTGGTTAGAGCGCACGCCTGATAAGCGTGAGGTCGGTGGTTCAAG |
Downstream region at tRNA end position |
tggcaagtcg |
Secondary structure (Cloverleaf model) | >WENV180468446 Ile GAT t ACCA tggcaagtcg G - C G - C G - C C - G C - G T - A A - T T G T C C A C C A C G A A | | | | | A T C T C G G G T G G C G | | | | T T G G A G C T T A G AGGTC C - G A - T C - G G - C C - G C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |