Sequence ID | >WENV180488256 |
Genome ID | OBZQ01005276 |
Search identical group | |
Phylum/Class | [OBZQ] human gut metagenome; faeces |
Species | |
Start position on genome | 2059 |
End posion on genome | 1975 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
aacggaattc |
tRNA gene sequence |
GCGGTCGTGGCGAAATTGGTAGACGCACTACTTTGAGGGGGTAGCGGAGCAATCCATATG |
Downstream region at tRNA end position |
agtttcgttg |
Secondary structure (Cloverleaf model) | >WENV180488256 Leu GAG c ACCA agtttcgttg G - C C - G G - C G - C T - A C - G G - C T A T T A C T C A T A A G | | | | | A T A G C G A T G A G C G | | | T T G A C G C T A G A CGGAGCAATCCAT C - G T - A A - T C - G T + G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |