Sequence ID | >WENV180498506 |
Genome ID | OCAG01000304 |
Search identical group | |
Phylum/Class | [OCAG] human gut metagenome; faeces |
Species | |
Start position on genome | 19356 |
End posion on genome | 19433 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
gtcattcgtT |
tRNA gene sequence |
GCCCCGGTAGCTCAGGGGATAGAGCACCGCTCTCCTAAAGCGGGTGTCGTGCGTTCGAAT |
Downstream region at tRNA end position |
Attcgactgg |
Secondary structure (Cloverleaf model) | >WENV180498506 Arg CCT T ACCC Attcgactgg G - C C - G C - G C - G C - G G - C G - C T A T T A C G C A G G A A + | | | | G G C T C G G T G C G C G | | | | T T A G A G C T A A GTGTC C - G C - G G - C C - G T - A C A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |