Sequence ID | >WENV180498932 |
Genome ID | OCAG01007662 |
Search identical group | |
Phylum/Class | [OCAG] human gut metagenome; faeces |
Species | |
Start position on genome | 802 |
End posion on genome | 725 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
aagacaacgt |
tRNA gene sequence |
GACTCAGTAGCTCAGCTGGATTAGAGTATTTGACTACGAATCAAAGGGTCGGGGGTTCGA |
Downstream region at tRNA end position |
ttttgatgaa |
Secondary structure (Cloverleaf model) | >WENV180498932 Arg ACG t ACCA ttttgatgaa G - C A - T C - G T + G C - G A - T G - C T A T C T C C C A T C G A A | + | | | G G C T C G G G G G G C G | | | + T T A G A G T T T A A GGGTC T - A T - A T - A G - C A - T C A T A A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |