Sequence ID | >WENV180500311 |
Genome ID | OCAI01008143 |
Search identical group | |
Phylum/Class | [OCAI] human gut metagenome; faeces |
Species | |
Start position on genome | 748 |
End posion on genome | 674 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
aacgataccc |
tRNA gene sequence |
GCTGGTGTGGCGCAATGGCAGCGCAACTGATTTGTAATCAGTGGGTTGCAGGTTCAACTC |
Downstream region at tRNA end position |
aaaagtccta |
Secondary structure (Cloverleaf model) | >WENV180500311 Thr TGT c TCCA aaaagtccta G - C C - G T - A G - C G - C T - A G - C T C T T G T C C A A A G + | | | | A T C G C G G C A G G C G | | | | T T G G C G C C A A GGGTT A - T C - G T - A G - C A - T T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |