Sequence ID | >WENV180503011 |
Genome ID | OCAM01001202 |
Search identical group | |
Phylum/Class | [OCAM] human gut metagenome; faeces |
Species | |
Start position on genome | 168 |
End posion on genome | 243 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
tataaaataa |
tRNA gene sequence |
GCCTCGATAGCTCAGTTGGTAGAGCAAGGGACTGAAAATCCCTGTGTCACTGGTTCGATT |
Downstream region at tRNA end position |
ttaaaattta |
Secondary structure (Cloverleaf model) | >WENV180503011 Phe GAA a ACCA ttaaaattta G - C C - G C - G T - A C - G G - C A - T T T T T G C C C A T G A A | | | | G T C T C G A C T G G C G | | | | T T G G A G C T A A GTGTC A - T G - C G - C G - C A - T C A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |