Sequence ID | >WENV180531826 |
Genome ID | OCHL01000001 |
Search identical group | |
Phylum/Class | [OCHL] human gut metagenome; human gut |
Species | |
Start position on genome | 151707 |
End posion on genome | 151635 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
aggtttttaa |
tRNA gene sequence |
TGGGCTATCGCCAAGCGGTAAGGCACAGGACTTTGACTCCTGCATTCGTTGGTTCGAATC |
Downstream region at tRNA end position |
ttttatttta |
Secondary structure (Cloverleaf model) | >WENV180531826 Gln TTG a GCtt ttttatttta T - A G - C G - C G - C C - G T - A A - T T A T C A A C C A G A C | | | | | G C A C C G G T T G G C G | | | T T G A G G C T A A CATTC C - G A - T G - C G - C A - T C C T A T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |