Sequence ID | >WENV180539085 |
Genome ID | OCHO01087545 |
Search identical group | |
Phylum/Class | [OCHO] human gut metagenome; human gut |
Species | |
Start position on genome | 58 |
End posion on genome | 134 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
ccaccaaaac |
tRNA gene sequence |
GGGCCCGTAGCTCAGCTGGCTAGAGCGTGCGACTGATAATCGCAAGGTCGGTGGTTCGAG |
Downstream region at tRNA end position |
aacaacgttt |
Secondary structure (Cloverleaf model) | >WENV180539085 Ile GAT c ACCA aacaacgttt G - C G - C G - C C - G C - G C - G G - C C G T T C A C C A C G A A + | | | | G T C T C G G G T G G C G | | | | T T G G A G C C T A G AGGTC T - A G - C C - G G - C A - T C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |