Sequence ID | >WENV180542911 |
Genome ID | OCHT01034390 |
Search identical group | |
Phylum/Class | [OCHT] human gut metagenome; human gut |
Species | |
Start position on genome | 541 |
End posion on genome | 465 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
tttcataaat |
tRNA gene sequence |
GGCGCGGTAGTTCAGTCGGTTAGAATGCCAGCCTGTCACGCTGGAGGTCGAGGGTTCGAG |
Downstream region at tRNA end position |
tttgccttgg |
Secondary structure (Cloverleaf model) | >WENV180542911 Asp GTC t GCCA tttgccttgg G - C G + T C - G G - C C - G G - C G - C C G T T T C C C A T G A A + | | | | G C C T T G G A G G G C G | | | + T T G G A A T T T A G AGGTC C - G C - G A - T G - C C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |