| Sequence ID | >WENV180544341 |
| Genome ID | OCIQ01000014 |
| Phylum/Class | [OCIQ] human gut metagenome; human gut |
| Species | |
| Start position on genome | 472 |
| End posion on genome | 544 |
| Amino Acid | Asp |
| Anticodon | GTC |
| Upstream region at tRNA start position |
agtatttcct |
| tRNA gene sequence |
GCCTTGGTGGTGTAGGGGCTATCATGTGGGCCTGTCGAGCCCGCGACTCGGGTTCAAATC |
| Downstream region at tRNA end position |
aatatttaaa |
| Secondary structure (Cloverleaf model) | >WENV180544341 Asp GTC
t GCtt aatatttaaa
G - C
C - G
C - G
T - A
T - A
G - C
G - C T A
T G G C C C A
G G A G + | | | | A
G T G T G T C G G G C
G | | + T T
C T C A T
T A G CGAC
T + G
G - C
G - C
G - C
C - G
C A
T G
G T C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |