Sequence ID | >WENV180551744 |
Genome ID | OCJG01043717 |
Search identical group | |
Phylum/Class | [OCJG] human oral metagenome; human oral |
Species | |
Start position on genome | 6 |
End posion on genome | 81 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
nnnnntttta |
tRNA gene sequence |
GGGTTCTTAGCTCAGCTGGTTCAGAGCATCTGCCTTACAAGCAGAGGGTCACTGGTTCGA |
Downstream region at tRNA end position |
aaaagtcatg |
Secondary structure (Cloverleaf model) | >WENV180551744 Val TAC a ACag aaaagtcatg G - C G - C G - C T - A T + G C - G T - A T A T T G A C C A T C G A A | | | | | G G C T C G A C T G G C G | | | | T T T G A G C T C A A GGGTC T - A C - G T - A G - C C - G C A T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |