Sequence ID | >WENV180557091 |
Genome ID | OCJV01000011 |
Search identical group | |
Phylum/Class | [OCJV] human gut metagenome; Infant 2 DOL 20 gut |
Species | |
Start position on genome | 48416 |
End posion on genome | 48340 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
gcttctcagg |
tRNA gene sequence |
GCGCCCTTAGCTCAGCTGGATAGAGCAACGGCCTTCTAAGCCGTAGGTCACAGGTTCGAA |
Downstream region at tRNA end position |
ttaagaaaca |
Secondary structure (Cloverleaf model) | >WENV180557091 Arg TCT g ACCA ttaagaaaca G + T C - G G - C C - G C - G C - G T - A C A T T G T C C A C G A A | | | | | G T C T C G A C A G G C G | | | | T T G G A G C A T A A AGGTC A - T C - G G - C G - C C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |