Sequence ID | >WENV180559665 |
Genome ID | OCKD01000031 |
Search identical group | |
Phylum/Class | [OCKD] human gut metagenome; Infant 2 DOL 27 gut |
Species | |
Start position on genome | 47305 |
End posion on genome | 47380 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
tggcgggcgt |
tRNA gene sequence |
GCCAACTTAGCTCAGTCGGTAGAGCGACGCTCTCGTAAAGCGTAGGTCACGGGTTCGATT |
Downstream region at tRNA end position |
tcatggccgg |
Secondary structure (Cloverleaf model) | >WENV180559665 Thr CGT t TCCA tcatggccgg G - C C - G C - G A - T A - T C - G T - A T T T T G C C C A T G A A | | | | | G C C T C G A C G G G C G | | | | T T G G A G C T A G AGGTC A - T C - G G - C C - G T - A C A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |