Sequence ID | >WENV180564667 |
Genome ID | OCLF01000171 |
Search identical group | |
Phylum/Class | [OCLF] human gut metagenome; human gut |
Species | |
Start position on genome | 14 |
End posion on genome | 90 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
tctaatcatg |
tRNA gene sequence |
GTGGCCGTAGTTCAGTTGGTTAGAGCGTCAGATTGTGGTTCTGAATGTCGTGGGTTCGAG |
Downstream region at tRNA end position |
agaggtaatt |
Secondary structure (Cloverleaf model) | >WENV180564667 His GTG g CCCA agaggtaatt G - C T - A G - C G - C C - G C T G - C T G T C A C C C A T G A A | | | | | G T C T T G G T G G G C G | | + | T T G G A G C T T A G ATGTC T - A C - G A - T G - C A - T T T T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |