Sequence ID | >W141055347 |
Genome ID | AONI01000009 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Litoreibacter arenae DSM 19593 [AONI] |
Start position on genome | 416745 |
End posion on genome | 416834 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
cctgcgccac |
tRNA gene sequence |
GGACAGGTGGCCGAGTGGTCGAAGGCGCACGCCTGGAAAGTGTGTAGGCGGGAGACCGTC |
Downstream region at tRNA end position |
ccaccccatt |
Secondary structure (Cloverleaf model) | >W141055347 Ser GGA c GCCA ccaccccatt G - C G - C A - T C - G A - T G - C G + T T A T G T C C C A T G A G | | | | | G G G C C G C A G G G C G | | | T T T A G G C C G A G TAGGCGGGAGACCGTCTC C - G A - T C - G G + T C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |