Sequence ID | >WENV180582189 |
Genome ID | OCMO01008074 |
Search identical group | |
Phylum/Class | [OCMO] metagenome; diffuse fluid |
Species | |
Start position on genome | 312 |
End posion on genome | 398 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
atttaaatgT |
tRNA gene sequence |
GCGGGGGTTGCCAAGCCTGGCCAAAGGCGCTAGGTTGAGGGCCTAGTCTCATAGGAGTTC |
Downstream region at tRNA end position |
tttttataac |
Secondary structure (Cloverleaf model) | >WENV180582189 Leu GAG T ATat tttttataac G - C C - G G - C G - C G - C G - C G - C T A T T T C C C A C C G A T + | | | | G T A C C G G A G G G C G | | | T T G A G G C C C A A G TCTCATAGGAGTTC C - G T - A A - T G - C G - C T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |