Sequence ID | >WENV180588141 |
Genome ID | OCOP01003612 |
Search identical group | |
Phylum/Class | [OCOP] marine metagenome; water |
Species | |
Start position on genome | 803 |
End posion on genome | 729 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
gccgcatttt |
tRNA gene sequence |
GGGCGGTTAGCTCAGCGGTAGAGCACTACGTTGACATCGTAGGGGTCACTGGTTCGATCC |
Downstream region at tRNA end position |
cgcagtaccc |
Secondary structure (Cloverleaf model) | >WENV180588141 Val GAC t ACCA cgcagtaccc G - C G - C G - C C - G G - C G - C T - A C T T T G A C C A G A A | | | | | G C C T C G A C T G G C G | | | | T T G G A G C T A A GGGTC C - G T - A A - T C - G G - C T T T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |