Sequence ID | >WENV180589055 |
Genome ID | OCOR01000002 |
Search identical group | |
Phylum/Class | [OCOR] marine metagenome; ENVO:00002042 |
Species | |
Start position on genome | 49180 |
End posion on genome | 49251 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
aacggatcaa |
tRNA gene sequence |
TGGGCCGTCGCCAAGTGGTAAGGCAGCGGGTTTTGGTCCCGCCATTCCTAGGTTCGAATC |
Downstream region at tRNA end position |
ttgtccatga |
Secondary structure (Cloverleaf model) | >WENV180589055 Gln TTG a Gttt ttgtccatga T - A G - C G - C G - C C - G C - G G - C T A T G A T C C A G A C | | | | | G T A C C G C T A G G C G | | | T T G A G G C T A A CATTC G - C C - G G - C G - C G - C T T T G T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |