Sequence ID | >WENV180593038 |
Genome ID | OCOX01000038 |
Search identical group | |
Phylum/Class | [OCOX] marine metagenome; ENVO:00002010 |
Species | |
Start position on genome | 14561 |
End posion on genome | 14485 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
aaagacaaat |
tRNA gene sequence |
GGTCCCGTAGCTCAGCTGGATAGAGTACTCGCCTCCGAAGCGAGGGGTCACAGGTTCAAA |
Downstream region at tRNA end position |
ttttcgaaaa |
Secondary structure (Cloverleaf model) | >WENV180593038 Arg CCG t ACCA ttttcgaaaa G - C G - C T - A C - G C - G C - G G - C T A T T G T C C A C G A A | | | | | A T C T C G A C A G G C G | | | + T T G G A G T A T A A GGGTC C - G T - A C - G G - C C - G C A T A C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |