Sequence ID | >WENV180596699 |
Genome ID | OCPI01000337 |
Search identical group | |
Phylum/Class | [OCPI] human gut metagenome; faeces |
Species | |
Start position on genome | 14117 |
End posion on genome | 14191 |
Amino Acid | Ile2 |
Anticodon | CAT |
Upstream region at tRNA start position |
tcgccaacgt |
tRNA gene sequence |
GGGGCTGTAGCTCAGTCGGTTAGAGCATCGGACTCATAATCCGCCGGTCCAGGGTTCAAG |
Downstream region at tRNA end position |
aaatccatgc |
Secondary structure (Cloverleaf model) | >WENV180596699 Ile2 CAT t ACtg aaatccatgc G - C G - C G - C G - C C - G T + G G - C C G T G T C C C A T G A A | | | | | A C C T C G C A G G G C G | | | | T T G G A G C T T A A CGGTC T C C - G G - C G - C A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |