Sequence ID | >WENV180599737 |
Genome ID | OCPP01004207 |
Search identical group | |
Phylum/Class | [OCPP] human gut metagenome; faeces |
Species | |
Start position on genome | 4660 |
End posion on genome | 4744 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
aaacaaaaat |
tRNA gene sequence |
GGGGGAGTTCCCGAGAGGCCAAAGGGGGCAGACTGTAAATCTGTTACGTTTCGTTTCGAT |
Downstream region at tRNA end position |
ttaataactt |
Secondary structure (Cloverleaf model) | >WENV180599737 Tyr GTA t ACCA ttaataactt G - C G - C G - C G - C G - C A - T G - C T A T C T G C C A A G A T | | + | | G G G C C C G A T G G C G | | | T T C A G G G C A A G TACGTTTCGTTTC G + T C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |