Sequence ID | >WENV180600301 |
Genome ID | OCPQ01000001 |
Search identical group | |
Phylum/Class | [OCPQ] human gut metagenome; faeces |
Species | |
Start position on genome | 14671 |
End posion on genome | 14597 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
aagtaaatat |
tRNA gene sequence |
TGGGGTGTCGTCAAGCGGTAAGACACAGCACTTTGACTGCTGCATTCGTAGGTTCAAATC |
Downstream region at tRNA end position |
aaaatcggca |
Secondary structure (Cloverleaf model) | >WENV180600301 Gln TTG t GCCA aaaatcggca T - A G - C G - C G - C G - C T - A G - C T A T C G T C C A G A C | + | | | A C A C T G G T A G G C G | | | T T G A G A C T A A CATTC C - G A - T G - C C - G A - T C C T A T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |