Sequence ID | >WENV180614520 |
Genome ID | OCPY01030014 |
Search identical group | |
Phylum/Class | [OCPY] human gut metagenome; human gut |
Species | |
Start position on genome | 840 |
End posion on genome | 767 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
nnnnnnnnnn |
tRNA gene sequence |
TCCTCCTTAGCTCAGTCGGTAGAGCATGCGGCTGTTAACCGCAGTGTCGTTGGTTCGAGT |
Downstream region at tRNA end position |
caaacccaat |
Secondary structure (Cloverleaf model) | >WENV180614520 Asn GTT n GCta caaacccaat T - A C - G C - G T + G C - G C - G T - A T G T C A A C C A T G A A | | | | | G C C T C G G T T G G C G | | | | T T G G A G C T A A GTGTC T - A G - C C - G G - C G - C C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |