Sequence ID | >WENV180621569 |
Genome ID | OCQC01002714 |
Search identical group | |
Phylum/Class | [OCQC] human gut metagenome; human gut |
Species | |
Start position on genome | 10312 |
End posion on genome | 10239 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
aaaagaataa |
tRNA gene sequence |
GGCCTAATGGCTCAGTTGGTTAGAGCGCCGCCCTGTCACGGCGGAGGTCGCGGGTTCGAG |
Downstream region at tRNA end position |
gtagtgaaga |
Secondary structure (Cloverleaf model) | >WENV180621569 Asp GTC a Gttc gtagtgaaga G - C G + T C - G C - G T + G A - T A - T T G T C G C C C A T G A G | | | | | G T C T C G G C G G G C G | | | | T T G G A G C T T A G AGGTC C - G C - G G - C C - G C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |