Sequence ID | >WENV180629621 |
Genome ID | OCQP01146281 |
Search identical group | |
Phylum/Class | [OCQP] human gut metagenome; human gut |
Species | |
Start position on genome | 196 |
End posion on genome | 270 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
aatttcatat |
tRNA gene sequence |
GTGCGTTTAGCTCAGCTGGATAGAGCGTTTGGCTACGGACCAAAAGGTCGGGGGTTCGAA |
Downstream region at tRNA end position |
tgtcgaaagg |
Secondary structure (Cloverleaf model) | >WENV180629621 Arg ACG t GCta tgtcgaaagg G - C T - A G - C C - G G - C T - A T - A T A T T C T C C A C G A A + | + | | G T C T C G G G G G G C G | | | | T T G G A G C A T A G AGGTC T - A T - A T - A G - C G - C C A T G A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |