Sequence ID | >WENV180634516 |
Genome ID | OCRB01019722 |
Search identical group | |
Phylum/Class | [OCRB] metagenome; diffuse fluid |
Species | |
Start position on genome | 190 |
End posion on genome | 114 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
ttgccgatat |
tRNA gene sequence |
GCCAGGGTAGCTCAGCCTGGGAGAGCACTCGGCTGAAGACCGAGCTGTCGCGCGTTCAAG |
Downstream region at tRNA end position |
atttttcaat |
Secondary structure (Cloverleaf model) | >WENV180634516 Phe GAA t ACCA atttttcaat G - C C - G C - G A - T G - C G - C G - C T G T C G C C C A C G A A | | | | A C C T C G G C G C G C T | | | | T T G G A G C G G A A CTGTC C - G T - A C - G G - C G - C C A T G G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |