| Sequence ID | >WENV180635334 |
| Genome ID | OCRD01009982 |
| Phylum/Class | [OCRD] marine metagenome; seawater |
| Species | |
| Start position on genome | 351 |
| End posion on genome | 434 |
| Amino Acid | Leu |
| Anticodon | CAA |
| Upstream region at tRNA start position |
ttgtgcacat |
| tRNA gene sequence |
GCCGGATTGGCGGAATGGCAGACGCGGAGCACTCAAAATGCTTTGTCCGAAAGGGCGTGT |
| Downstream region at tRNA end position |
tttctccaca |
| Secondary structure (Cloverleaf model) | >WENV180635334 Leu CAA
t ACtt tttctccaca
G - C
C - G
C - G
G - C
G - C
A - T
T - A T A
T C A C C C A
T A A G | | | | | A
G G G C G G T G G G C
G | | | T T
C A C G C
A G G TGTCCGAAAGGGCGT
G + T
A - T
G - C
C - G
A - T
C A
T A
C A A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |