| Sequence ID | >WENV180635838 |
| Genome ID | OCRE01013987 |
| Phylum/Class | [OCRE] marine metagenome; Seawater |
| Species | |
| Start position on genome | 384 |
| End posion on genome | 457 |
| Amino Acid | Arg |
| Anticodon | CCT |
| Upstream region at tRNA start position |
ctgttttcgc |
| tRNA gene sequence |
GGCCCCGTAGCTCAGGGGATAGAGCGTCGGTTTCCTAAACCGTGCGTCGCAGGTTCGAAT |
| Downstream region at tRNA end position |
tgcaaaagcc |
| Secondary structure (Cloverleaf model) | >WENV180635838 Arg CCT
c ACgc tgcaaaagcc
G - C
G - C
C - G
C - G
C - G
C - G
G - C T A
T C G T C C A
G G A A | | | | | G
G C T C G G C A G G C
G | | | | T T
A G A G C
T A G GCGTC
T T
C - G
G - C
G - C
T - A
T A
T A
C C T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |