Sequence ID | >WENV180648176 |
Genome ID | OCSI01111391 |
Search identical group | |
Phylum/Class | [OCSI] metagenome; diffuse fluid |
Species | |
Start position on genome | 159 |
End posion on genome | 83 |
Amino Acid | fMet |
Anticodon | CAT |
Upstream region at tRNA start position |
agtgagttga |
tRNA gene sequence |
CGCGGGGTGGAGCAGTCCGGTAGCTCGTTGGGCTCATAACCCAAAGGTCGGGGGTTCAAA |
Downstream region at tRNA end position |
accttgtgag |
Secondary structure (Cloverleaf model) | >WENV180648176 fMet CAT a ACCA accttgtgag C A G - C C - G G - C G - C G - C G - C T A T C C C C C A T G A G | | | | | A C C G A G G G G G G C C | | | | T T G G C T C G T A G AGGTC T - A T - A G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |