Sequence ID | >WENV180648534 |
Genome ID | OCSJ01038668 |
Search identical group | |
Phylum/Class | [OCSJ] human gut metagenome; human gut |
Species | |
Start position on genome | 306 |
End posion on genome | 231 |
Amino Acid | Lys |
Anticodon | CTT |
Upstream region at tRNA start position |
tcattcctgt |
tRNA gene sequence |
GCCTCGTTAGCTCAGTTGGTAGAGCAGCTGACTCTTAATCAGTTTGTCCACGGTTCGAGC |
Downstream region at tRNA end position |
tttcttttct |
Secondary structure (Cloverleaf model) | >WENV180648534 Lys CTT t ACCA tttcttttct G + T C - G C - G T + G C - G G - C T - A C G T G T G C C A T G A A | | | | | G T C T C G C A C G G C G | | | | T T G G A G C T A A TTGTC G + T C - G T - A G - C A - T C A T A C T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |