Sequence ID | >W141063804 |
Genome ID | APJG01000013 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Afipia sp. OHSU_I-uncloned [APJG] |
Start position on genome | 62520 |
End posion on genome | 62594 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
tctggcgttc |
tRNA gene sequence |
GCTGCCGTAGCTCAGTGGTAGAGCACTCCATTGGTAATGGAGAGGTCGACAGTTCAATCC |
Downstream region at tRNA end position |
gccctctcaa |
Secondary structure (Cloverleaf model) | >W141063804 Thr GGT c ACCA gccctctcaa G - C C - G T - A G - C C - G C - G G + T C T T C T G T C A G A A | | | | | A T C T C G G A C A G C G | | | | T T G G A G C T A A AGGTC C - G T - A C - G C - G A - T T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |