Sequence ID | >W141063875 |
Genome ID | APJI01000004 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Afipia sp. OHSU_II-C1 [APJI] |
Start position on genome | 178674 |
End posion on genome | 178749 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
cgcgacacgt |
tRNA gene sequence |
GAGCGCGTAGCTCAGGCGGTAGAGCACGTGACTTTTAATCATGGGGTCGAGGGTTCGAGT |
Downstream region at tRNA end position |
tggtgccctg |
Secondary structure (Cloverleaf model) | >W141063875 Lys TTT t ACCA tggtgccctg G - C A - T G - C C - G G - C C - G G - C T G T C T C C C A G G A A | | | | | G C C T C G G A G G G C G | | | | T T G G A G C T A A GGGTC C - G G + T T - A G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |