Sequence ID | >WENV180678414 |
Genome ID | OCVV011973584 |
Search identical group | |
Phylum/Class | [OCVV] gut metagenome; gut |
Species | |
Start position on genome | 107 |
End posion on genome | 32 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
taacatactt |
tRNA gene sequence |
GCCACTTTAGCTCAGCTGGCAGAGCATCTCATTCGTAATGAGAGGGTCGTAGGTTCAAAT |
Downstream region at tRNA end position |
gtaaatatgc |
Secondary structure (Cloverleaf model) | >WENV180678414 Thr CGT t TCCA gtaaatatgc G - C C - G C - G A - T C - G T - A T - A T A T T A T C C A C G A A + | | | | A T C T C G G T A G G C G | | | | T T G G A G C C A A GGGTC T - A C - G T - A C - G A - T T A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |