Sequence ID | >WENV180685546 |
Genome ID | OCVV012873911 |
Search identical group | |
Phylum/Class | [OCVV] gut metagenome; gut |
Species | |
Start position on genome | 3278 |
End posion on genome | 3354 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
cattataaaa |
tRNA gene sequence |
GGCGGCATAGCTCAGTTGGCTAGAGCAAGCGGTTCATACCCGCTGTGTCCGCGGTTCAAA |
Downstream region at tRNA end position |
atattaaaga |
Secondary structure (Cloverleaf model) | >WENV180685546 Met CAT a ACCA atattaaaga G - C G - C C - G G - C G - C C - G A - T T A T G T G C C A T G A A | + | | | A T C T C G C G C G G C G | | | | T T G G A G C C T A A GTGTC A - T G - C C - G G - C G - C T C T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |