Sequence ID | >WENV180692491 |
Genome ID | OCZS010569918 |
Search identical group | |
Phylum/Class | [OCZS] soil metagenome; soil |
Species | |
Start position on genome | 1 |
End posion on genome | 76 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
nnnnnnnnnn |
tRNA gene sequence |
GCCGATGTAGCTCAGTTGGCAGAGCGCGTCCTTGGTAAGGACGAGGTCACCAGTTCAATC |
Downstream region at tRNA end position |
tccttcgctc |
Secondary structure (Cloverleaf model) | >WENV180692491 Thr GGT n TCCA tccttcgctc G - C C - G C - G G - C A - T T - A G - C C T T T G G T C A T G A A | | | | | A T C T C G A C C A G C G | | | | T T G G A G C C A G AGGTC C - G G - C T - A C - G C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |