| Sequence ID | >WENV180696833 |
| Genome ID | ODCW01001199 |
| Phylum/Class | [ODCW] human metagenome; G_DNA_Buccal mucosa |
| Species | |
| Start position on genome | 496 |
| End posion on genome | 570 |
| Amino Acid | Met |
| Anticodon | CAT |
| Upstream region at tRNA start position |
ggatcacatt |
| tRNA gene sequence |
GGCGGGGTAGCTCAGGGGTAGAGCAAGCGGCTCATAATCGCTGTGTCGCGGGTTCGATTC |
| Downstream region at tRNA end position |
atttaaccgg |
| Secondary structure (Cloverleaf model) | >WENV180696833 Met CAT
t ACCA atttaaccgg
G + T
G - C
C - G
G - C
G - C
G - C
G + T T T
T C G C C C A
G A A | | | | | G
G C T C G G C G G G C
G | | | | T T
G G A G C
T A A GTGTC
A - T
G - C
C - G
G - C
G + T
C A
T A
C A T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |