Sequence ID | >WENV180697802 |
Genome ID | ODDE01005446 |
Search identical group | |
Phylum/Class | [ODDE] human metagenome; G_DNA_Supragingival plaque |
Species | |
Start position on genome | 281 |
End posion on genome | 206 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
ggagccattt |
tRNA gene sequence |
GACTCACTAGCTCAGTTGGCAGAGCACCTGACTTTTAATCAGGGTGTCCCGCGTTCGAGT |
Downstream region at tRNA end position |
tttctggccc |
Secondary structure (Cloverleaf model) | >WENV180697802 Lys TTT t ACCA tttctggccc G - C A - T C - G T - A C - G A - T C - G T G T G G C G C A T G A A | | | | | G T C T C G C C G C G C G | | | | T T G G A G C C A A GTGTC C - G C - G T - A G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |