Sequence ID | >WENV180697853 |
Genome ID | ODDE01007199 |
Search identical group | |
Phylum/Class | [ODDE] human metagenome; G_DNA_Supragingival plaque |
Species | |
Start position on genome | 898 |
End posion on genome | 983 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
ttgcgcctca |
tRNA gene sequence |
GGAGGATTCGCCTAGTGGCCTATGGCGCACGCTTGGAAAGCGTGTTGGGTGCAAGCCCTC |
Downstream region at tRNA end position |
cagttgactt |
Secondary structure (Cloverleaf model) | >WENV180697853 Ser GGA a GCta cagttgactt G - C G - C A - T G - C G - C A - T T - A T A T C C C C C A T G A C | | | | | G G T C C G G G G G G C G | | | T T C T G G C C T A G TTGGGTGCAAGCCCTC C - G A - T C - G G - C C - G T A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |