Sequence ID | >WENV180698591 |
Genome ID | ODDH01030659 |
Search identical group | |
Phylum/Class | [ODDH] human metagenome; G_DNA_Buccal mucosa |
Species | |
Start position on genome | 165 |
End posion on genome | 238 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
tgagaactac |
tRNA gene sequence |
GGGTCTTTAGCTCAGCTGGTAGAGCGCCACGTTTACACCGTGGATGTCATCGGTTCGATC |
Downstream region at tRNA end position |
ataaatcccg |
Secondary structure (Cloverleaf model) | >WENV180698591 Val TAC c ACat ataaatcccg G - C G - C G - C T - A C - G T + G T - A C T T T G G C C A C G A A | + | | | G T C T C G A T C G G C G | | | | T T G G A G C T A G ATGTC C - G C - G A - T C - G G - C T C T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |